Stem-loop sequence ami-mir-1805

AccessionMI0029858 (change log)
DescriptionAlligator mississippiensis miR-1805 stem-loop
Stem-loop
   -------u    ua   u            c      -    a cuu  ca 
5'         ggaa  uuc gggaguuguagu uuucaa acag g   ug  a
           ||||  ||| |||||||||||| |||||| |||| |   ||   
3'         ccuu  aag cccucgacauca aagguu uguc c   ac  g
   acugugau    -c   u            c      a    - -au  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001628.1: 19192125-19192217 [+]
intergenic
Database links

Mature sequence ami-miR-1805-5p

Accession MIMAT0038329
Sequence

15 - 

aguuguagucuuucaaacaga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1805-3p

Accession MIMAT0038330
Sequence

54 - 

uguauuggaacacuacagcucc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).