Stem-loop sequence ami-mir-1791

AccessionMI0029857 (change log)
DescriptionAlligator mississippiensis miR-1791 stem-loop
Stem-loop
   u      c     ug g    c       ---   --cau   a 
5'  gaugca caugu  g cugc ucaguca   ugc     guu u
    |||||| |||||  | |||| |||||||   |||     |||  
3'  cugugu gugca  c gacg agucagu   acg     caa g
   a      a     gu g    u       gua   uaauc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003905.1: 1986165-1986249 [+]
intergenic
Database links

Mature sequence ami-miR-1791-5p

Accession MIMAT0038327
Sequence

14 - 

ugggcugccucagucaugccaug

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1791-3p

Accession MIMAT0038328
Sequence

52 - 

caaugugacugaugcaggcugac

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).