Stem-loop sequence ami-mir-1720

AccessionMI0029855 (change log)
DescriptionAlligator mississippiensis miR-1720 stem-loop
Stem-loop
   ---c   u    --a    ag           --       
5'     uuc gauc   ccuc  uuguugcuuuu  gugagc 
       ||| ||||   ||||  |||||||||||  ||||| a
3'     aag cugg   ggag  aacaacgaaag  uacuuu 
   ccca   u    acg    --           gg       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006295.1: 11914844-11914915 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-1720
ami-mir-7a-2AKHW03006295.1: 11914583-11914671 [+]
ami-mir-1720AKHW03006295.1: 11914844-11914915 [+]
Database links

Mature sequence ami-miR-1720-3p

Accession MIMAT0038324
Sequence

45 - 

aagcaacaagagggcaggucuga

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).