Stem-loop sequence ami-mir-1662

AccessionMI0029851 (change log)
DescriptionAlligator mississippiensis miR-1662 stem-loop
Stem-loop
   -    ---a  u  gc   a              u aua        guaug 
5'  gcag    gc gu  ucu uggguuugacauca c   cuugggau     u
    ||||    || ||  ||| |||||||||||||| |   ||||||||      
3'  uguc    cg cg  aga acccggacuguagu g   gaacccug     c
   c    cuac  u  uu   -              c gaa        aaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000487.1: 29917407-29917507 [+]
intergenic
Database links

Mature sequence ami-miR-1662-5p

Accession MIMAT0038318
Sequence

22 - 

uugacaucaucauacuuggga

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).