Stem-loop sequence ami-mir-1388

AccessionMI0029847 (change log)
DescriptionAlligator mississippiensis miR-1388 stem-loop
Stem-loop
   -a u     -     cc  -  a   u u         augg   aa a 
5'   g gaggg gcguc  ca gg cug c aaccugaga    uga  c c
     | ||||| |||||  || || ||| | |||||||||    |||  |  
3'   c cucuc cgcag  gu cc gac g uuggacucu    acu  g g
   ga -     u     -a  a  c   u c         ---a   gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004329.1: 954498-954589 [+]
intergenic
Database links

Mature sequence ami-miR-1388-5p

Accession MIMAT0038312
Sequence

17 - 

aggacugucuaaccugagaaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-1388-3p

Accession MIMAT0038313
Sequence

56 - 

aucucagguucgucagcccau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).