Stem-loop sequence ami-mir-489

AccessionMI0029836 (change log)
DescriptionAlligator mississippiensis miR-489 stem-loop
Stem-loop
   -- ug ug c    ug             c      ua     a 
5'   g  g  g uugg  gucguauguauga gucauu  cuugg c
     |  |  | ||||  ||||||||||||| ||||||  |||||  
3'   c  c  c aauc  cggcauguauacu caguga  ggauu u
   ua gu gu a    gu             a      --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03005461.1: 7248472-7248557 [-]
intergenic
Database links

Mature sequence ami-miR-489-5p

Accession MIMAT0038295
Sequence

13 - 

uggucguauguaugacgucauu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-489-3p

Accession MIMAT0038296
Sequence

53 - 

ugacaucauauguacggcugcu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).