Stem-loop sequence ami-mir-456

AccessionMI0029831 (change log)
DescriptionAlligator mississippiensis miR-456 stem-loop
Stem-loop
   ---u   u        g   g     uc       acau ug    c 
5'     gug auguguga cag caucu  ucagccu    g  gauu u
       ||| |||||||| ||| |||||  |||||||    |  ||||  
3'     cac uacauacu guu guaga  ggucgga    c  cuaa u
   aguc   u        -   g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006164.1: 11020018-11020105 [+]
intergenic
Database links

Mature sequence ami-miR-456-3p

Accession MIMAT0038289
Sequence

54 - 

caggcugguuagaugguugu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).