Stem-loop sequence ami-mir-454

AccessionMI0029829 (change log)
DescriptionAlligator mississippiensis miR-454 stem-loop
Stem-loop
   aa    -     u          ---         -  -       ug 
5'   ccuu aagga aagacccuau   caauauugc cu cugcuuu  u
     |||| ||||| ||||||||||   ||||||||| || |||||||  g
3'   ggag uuucu uucugggaua   guuauaacg ga gauggga  a
   ug    g     u          uuc         u  u       cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002185.1: 17721-17813 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-454
ami-mir-130bAKHW03002185.1: 25772-25867 [-]
ami-mir-301bAKHW03002185.1: 24520-24616 [-]
ami-mir-454AKHW03002185.1: 17721-17813 [-]
Database links

Mature sequence ami-miR-454-5p

Accession MIMAT0038285
Sequence

16 - 

acccuaucaauauugccucugcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-454-3p

Accession MIMAT0038286
Sequence

55 - 

uagugcaauauugcuuauagggucu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).