Stem-loop sequence ami-mir-449d

AccessionMI0029828 (change log)
DescriptionAlligator mississippiensis miR-449d stem-loop
Stem-loop
   -a       g     auua  c     auug      a     cauu 
5'   ugugugu ugaug    gg agugu    uuaguu gcugg    c
     ||||||| |||||    || |||||    |||||| |||||     
3'   acacacg auuac    cc ucaca    aaucaa cgacc    a
   ca       -     ---a  u     --ca      -     auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004724.1: 29164098-29164185 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-449d
ami-mir-449cAKHW03004724.1: 29165962-29166046 [-]
ami-mir-449bAKHW03004724.1: 29165474-29165573 [-]
ami-mir-449aAKHW03004724.1: 29165327-29165416 [-]
ami-mir-449dAKHW03004724.1: 29164098-29164185 [-]
Database links

Mature sequence ami-miR-449d-5p

Accession MIMAT0038284
Sequence

18 - 

aggcaguguauuguuaguuagc

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).