Stem-loop sequence ami-mir-449b

AccessionMI0029826 (change log)
DescriptionAlligator mississippiensis miR-449b stem-loop
Stem-loop
   -u   -  u       u   gua         cugu    u       uu  g 
5'   agc gc cccugug cug   ggcagugua    uagc ggcugcu  gu u
     ||| || ||||||| |||   |||||||||    |||| |||||||  ||  
3'   ucg cg gggacgu gac   cugucacgu    aucg cugacga  ua g
   ac   a  -       c   -aa         ---c    -       uc  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004724.1: 29165474-29165573 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-449b
ami-mir-449cAKHW03004724.1: 29165962-29166046 [-]
ami-mir-449bAKHW03004724.1: 29165474-29165573 [-]
ami-mir-449aAKHW03004724.1: 29165327-29165416 [-]
ami-mir-449dAKHW03004724.1: 29164098-29164185 [-]
Database links

Mature sequence ami-miR-449b-5p

Accession MIMAT0038282
Sequence

21 - 

aggcaguguacuguuagcuggcu

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).