Stem-loop sequence ami-mir-449a

AccessionMI0029825 (change log)
DescriptionAlligator mississippiensis miR-449a stem-loop
Stem-loop
   -------g     ga     a     -    c           gucag 
5'         ugugu  uggga ggcag ugua uguuagcuggu     u
           |||||  ||||| ||||| |||| |||||||||||     u
3'         acacg  auccu ucguc acgu acaaucgacca     u
   aguuucaa     uc     a     g    -           acuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004724.1: 29165327-29165416 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-449a
ami-mir-449cAKHW03004724.1: 29165962-29166046 [-]
ami-mir-449bAKHW03004724.1: 29165474-29165573 [-]
ami-mir-449aAKHW03004724.1: 29165327-29165416 [-]
ami-mir-449dAKHW03004724.1: 29164098-29164185 [-]
Database links

Mature sequence ami-miR-449a-5p

Accession MIMAT0038281
Sequence

14 - 

aggcaguguacuguuagcuggu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).