Stem-loop sequence ami-mir-383

AccessionMI0029822 (change log)
DescriptionAlligator mississippiensis miR-383 stem-loop
Stem-loop
   c  ca   -   c     -c  a      aa    a        --    gu 
5'  gc  agu cac ugcuc  uc gaucag  ggug uuguggcu  uuga  a
    ||  ||| ||| |||||  || ||||||  |||| ||||||||  ||||  g
3'  cg  uca gug acgag  ag cugguc  ucac gacaccga  aauu  a
   c  -a   u   a     aa  a      cg    -        cg    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000533.1: 47528493-47528593 [-]
intergenic
Database links

Mature sequence ami-miR-383-5p

Accession MIMAT0038276
Sequence

21 - 

agaucagaaggugauugugg

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).