Stem-loop sequence ami-mir-365-2

AccessionMI0029819 (change log)
DescriptionAlligator mississippiensis miR-365-2 stem-loop
Stem-loop
   ---guggca       a        ac   c       -----    u   u 
5'          gcaagaa aaugaggg  uuu aggggca     gcug guu u
            ||||||| ||||||||  ||| |||||||     |||| ||| a
3'          cguucuu uuauuccu  aaa uccccgu     ugac caa c
   aacuuguaa       g        aa   -       aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004113.1: 5161026-5161123 [-]
intergenic
Database links

Mature sequence ami-miR-365-2-5p

Accession MIMAT0038273
Sequence

19 - 

agggacuuucaggggcagcugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-365-3p

Accession MIMAT0038272
Sequence

59 - 

uaaugccccuaaaaauccuua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).