Stem-loop sequence ami-mir-338-1

AccessionMI0029816 (change log)
DescriptionAlligator mississippiensis miR-338-1 stem-loop
Stem-loop
   ccacuu    c g     c      u   -         agc    ug g 
5'       gcuc c ccucc caacaa auc cuggugcug   gagu  c c
         |||| | ||||| |||||| ||| |||||||||   ||||  | a
3'       cgag g ggagg guuguu uag gacuacgac   cuca  g c
   ccgucu    c -     a      u   u         ---    ga a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001221.1: 14501-14598 [-]
intergenic
Database links

Mature sequence ami-miR-338-5p

Accession MIMAT0038268
Sequence

21 - 

aacaauauccuggugcugagcg

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-338-3p

Accession MIMAT0038269
Sequence

59 - 

uccagcaucagugauuuuguug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).