Stem-loop sequence ami-mir-302c

AccessionMI0029814 (change log)
DescriptionAlligator mississippiensis miR-302c stem-loop
Stem-loop
   uua   a   u  u ug  uu             c    gccu 
5'    aac gcc cc u  cu  aacauggagguac ugcu    a
      ||| ||| || |  ||  ||||||||||||| ||||     
3'    uug ugg gg g  ga  uuguaccuucgug auga    a
   ucc   a   u  u gu  cu             a    aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006071.1: 213788-213875 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-302c
ami-mir-302bAKHW03006071.1: 213474-213570 [+]
ami-mir-302cAKHW03006071.1: 213788-213875 [+]
ami-mir-302aAKHW03006071.1: 214064-214159 [+]
ami-mir-302dAKHW03006071.1: 214390-214469 [+]
ami-mir-367AKHW03006071.1: 214626-214721 [+]
Database links

Mature sequence ami-miR-302c-3p

Accession MIMAT0038266
Sequence

52 - 

uaagugcuuccauguuucagug

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).