Stem-loop sequence ami-mir-302b

AccessionMI0029813 (change log)
DescriptionAlligator mississippiensis miR-302b stem-loop
Stem-loop
   -   g  u      c        uu          ug   u  gugac 
5'  gaa ua gguuuc cuucuacu  aacauggagg  cuu cu     u
    ||| || |||||| ||||||||  ||||||||||  ||| ||     u
3'  cuu gu cuaaag ggagauga  uuguaccuuc  gaa ga     a
   u   -  c      u        uu          gu   u  agaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006071.1: 213474-213570 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-302b
ami-mir-302bAKHW03006071.1: 213474-213570 [+]
ami-mir-302cAKHW03006071.1: 213788-213875 [+]
ami-mir-302aAKHW03006071.1: 214064-214159 [+]
ami-mir-302dAKHW03006071.1: 214390-214469 [+]
ami-mir-367AKHW03006071.1: 214626-214721 [+]
Database links

Mature sequence ami-miR-302b-3p

Accession MIMAT0038265
Sequence

58 - 

uaagugcuuccauguuuuagu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).