Stem-loop sequence ami-mir-302a

AccessionMI0029812 (change log)
DescriptionAlligator mississippiensis miR-302a stem-loop
Stem-loop
   --   uuaa    cc -    a   uu        u           guu 
5'   agc    agga  c ccag acu  aaugugga guacuugcuuu   u
     |||    ||||  | |||| |||  |||||||| |||||||||||   c
3'   ucg    uccu  g gguc ugg  uuguaccu cgugaaugaaa   u
   uc   ----    aa u    g   uu        u           aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006071.1: 214064-214159 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-302a
ami-mir-302bAKHW03006071.1: 213474-213570 [+]
ami-mir-302cAKHW03006071.1: 213788-213875 [+]
ami-mir-302aAKHW03006071.1: 214064-214159 [+]
ami-mir-302dAKHW03006071.1: 214390-214469 [+]
ami-mir-367AKHW03006071.1: 214626-214721 [+]
Database links

Mature sequence ami-miR-302a-3p

Accession MIMAT0038264
Sequence

58 - 

uaagugcuuccauguuuuggug

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).