Stem-loop sequence ami-mir-219a

AccessionMI0029804 (change log)
DescriptionAlligator mississippiensis miR-219a stem-loop
Stem-loop
   ---u     c   g       u     a  g         u uc 
5'     gagcg cgg uccugau gucca ac caauucuug g  u
       ||||| ||| ||||||| ||||| || ||||||||| |   
3'     cuugc gcc agggcug caggu ug guuaagaac c  g
   accc     c   g       -     g  a         - cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003855.1: 103721-103805 [-]
intergenic
Database links

Mature sequence ami-miR-219a-5p

Accession MIMAT0038248
Sequence

15 - 

ugauuguccaaacgcaauucuug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-219a-3p

Accession MIMAT0038249
Sequence

49 - 

agaauugaguguggacgucggg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).