Stem-loop sequence ami-mir-218-2

AccessionMI0029803 (change log)
DescriptionAlligator mississippiensis miR-218-2 stem-loop
Stem-loop
   a   g        uuu         cu        ------g   ga 
5'  aug gguuuucc   gugcuugau  aaccaugu       gua  a
    ||| ||||||||   |||||||||  ||||||||       |||   
3'  uac ucggaagg   cacgaacug  uugguaca       cau  c
   a   g        uac         uc        aguuaaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002337.1: 9433963-9434052 [+]
intergenic
Database links

Mature sequence ami-miR-218-5p

Accession MIMAT0038247
Sequence

15 - 

uugugcuugaucuaaccaugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).