Stem-loop sequence ami-mir-215

AccessionMI0029798 (change log)
DescriptionAlligator mississippiensis miR-215 stem-loop
Stem-loop
   aacugu         a a  a     -   u        ugu  au 
5'       ugugcagga a ug ccuau gaa ugacagac   gu  u
         ||||||||| | || ||||| ||| ||||||||   ||  c
3'       acacgucuu u ac ggaug cuu acugucug   cg  u
   -cuucc         a a  c     u   u        -uu  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001146.1: 13838061-13838152 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-215
ami-mir-194-1AKHW03001146.1: 13837746-13837839 [+]
ami-mir-215AKHW03001146.1: 13838061-13838152 [+]
Database links

Mature sequence ami-miR-215-5p

Accession MIMAT0038240
Sequence

18 - 

augaccuaugaauugacagac

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-215-3p

Accession MIMAT0038241
Sequence

56 - 

ucugucauuucuguaggccaau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).