Stem-loop sequence ami-mir-206

AccessionMI0029793 (change log)
DescriptionAlligator mississippiensis miR-206 stem-loop
Stem-loop
   cu       u     a                cc      g au 
5'   ucucuuu gaggc acaugcuucuuuauau  ccauag g  a
     ||||||| ||||| ||||||||||||||||  |||||| |  a
3'   agagggg cuuug ugugugaaggaaugua  gguauc u  c
   gu       -     g                -a      g ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003504.1: 2014183-2014271 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-206
ami-mir-206AKHW03003504.1: 2014183-2014271 [+]
ami-mir-133bAKHW03003504.1: 2019326-2019413 [+]
Database links

Mature sequence ami-miR-206-5p

Accession MIMAT0038231
Sequence

17 - 

acaugcuucuuuauauccccau

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-206-3p

Accession MIMAT0038232
Sequence

55 - 

uggaauguaaggaagugugugg

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).