Stem-loop sequence ami-mir-205b

AccessionMI0029792 (change log)
DescriptionAlligator mississippiensis miR-205b stem-loop
Stem-loop
   --      gcuu     u cc       c   c       gua  gau 
5'   uccaug    ucugg g  cuucauu cac ggaaucu   gg   c
     ||||||    ||||| |  ||||||| ||| |||||||   ||    
3'   aggugc    agacu c  gaaguaa gug cuuuaga   cc   a
   ua      ----     c cc       a   a       ---  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002440.1: 27055187-27055275 [+]
intergenic
Database links

Mature sequence ami-miR-205b-5p

Accession MIMAT0038230
Sequence

18 - 

cccuucauuccaccggaaucugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).