Stem-loop sequence ami-mir-205a

AccessionMI0029791 (change log)
DescriptionAlligator mississippiensis miR-205a stem-loop
Stem-loop
   ----      gau   g    c           c        ucuca 
5'     uccaug   ucu uugu cuucauuccac ggagucug     u
       ||||||   ||| |||| ||||||||||| ||||||||     a
3'     agguac   aga aaca gaagugaggug cuuuagac     c
   guug      ---   g    c           a        uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006004.1: 182483-182572 [-]
intergenic
Database links

Mature sequence ami-miR-205a-5p

Accession MIMAT0038228
Sequence

17 - 

uccuucauuccaccggagucug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-205a-3p

Accession MIMAT0038229
Sequence

54 - 

gauuucaguggagugaagcaca

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).