Stem-loop sequence ami-mir-200b

AccessionMI0029786 (change log)
DescriptionAlligator mississippiensis miR-200b stem-loop
Stem-loop
   uccu          uac    -    ug     c      uguuu 
5'     gggaugccgu   cauc uuac  ggcag auugga     u
       ||||||||||   |||| ||||  ||||| ||||||     c
3'     cucuguggua   guag aaug  ccguc uaaucu     u
   --cg          uua    u    gu     a      uugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004073.1: 9496695-9496784 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-200b
ami-mir-200bAKHW03004073.1: 9496695-9496784 [+]
ami-mir-200aAKHW03004073.1: 9499070-9499160 [+]
ami-mir-429AKHW03004073.1: 9503570-9503663 [+]
Database links

Mature sequence ami-miR-200b-5p

Accession MIMAT0038220
Sequence

18 - 

caucuuacugggcagcauugg

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-200b-3p

Accession MIMAT0038221
Sequence

55 - 

uaauacugccugguaaugaugau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).