Stem-loop sequence ami-mir-199-3

AccessionMI0029784 (change log)
DescriptionAlligator mississippiensis miR-199-3 stem-loop
Stem-loop
   u   - u c     c       u        c   u   gacu 
5'  cca c c gucug ccagugu cagacuac ugu cag    a
    ||| | | ||||| ||||||| |||||||| ||| |||     
3'  ggu g g cggau gguuaca gucugaug aca guu    c
   g   c u u     u       c        -   u   agag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006215.1: 13712816-13712901 [+]
intergenic
Database links

Mature sequence ami-miR-199-5p

Accession MIMAT0038216
Sequence

14 - 

cccaguguucagacuaccuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-199-3p

Accession MIMAT0038217
Sequence

53 - 

acaguagucugcacauugguua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).