Stem-loop sequence ami-mir-199-2

AccessionMI0029783 (change log)
DescriptionAlligator mississippiensis miR-199-2 stem-loop
Stem-loop
   ---   -    c   gcc       u        c   ---u   ga 
5'    ccu gcuc guc   ccagugu cagacuac ugu    cag  c
      ||| |||| |||   ||||||| |||||||| |||    |||  a
3'    gga cggg cag   gguuaca gucugaug aca    guc  a
   aag   a    u   auu       c        -   uguu   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002184.1: 581623-581711 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-199-2
ami-mir-199-2AKHW03002184.1: 581623-581711 [-]
ami-mir-214AKHW03002184.1: 575707-575799 [-]
Database links

Mature sequence ami-miR-199-5p

Accession MIMAT0038216
Sequence

14 - 

cccaguguucagacuaccuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-199-3p

Accession MIMAT0038217
Sequence

53 - 

acaguagucugcacauugguua

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).