Stem-loop sequence ami-mir-199-1

AccessionMI0029782 (change log)
DescriptionAlligator mississippiensis miR-199-1 stem-loop
Stem-loop
   -a   c     agc   c       u        c   u   gag a 
5'   guc agccc   cug ccagugu cagacuac ugu cag   c u
     ||| |||||   ||| ||||||| |||||||| ||| |||   |  
3'   cgg ucggg   gau gguuaca gucugaug aca guu   g a
   ua   u     cua   u       c        -   u   gaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001975.1: 179922-180015 [-]
intergenic
Database links

Mature sequence ami-miR-199-5p

Accession MIMAT0038216
Sequence

17 - 

cccaguguucagacuaccuguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-199-3p

Accession MIMAT0038217
Sequence

58 - 

acaguagucugcacauugguua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).