Stem-loop sequence ami-mir-191

AccessionMI0029773 (change log)
DescriptionAlligator mississippiensis miR-191 stem-loop
Stem-loop
   -   --ac      c          c  aa       -ucuu  g 
5'  gcg    agcggg aacggaaucc aa  gcagcug     cc c
    |||    |||||| |||||||||| ||  |||||||     ||  
3'  cgc    ucgucc uugcuuuagg uu  cgucgac     gg u
   c   ccuc      c          -  cg       uccac  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003150.1: 63654-63740 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-191
ami-mir-191AKHW03003150.1: 63654-63740 [+]
ami-mir-425AKHW03003150.1: 64121-64213 [+]
ami-mir-2970AKHW03003150.1: 64489-64586 [+]
Database links

Mature sequence ami-miR-191-5p

Accession MIMAT0038205
Sequence

12 - 

caacggaaucccaaaagcagcu

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).