Stem-loop sequence ami-mir-182

AccessionMI0029767 (change log)
DescriptionAlligator mississippiensis miR-182 stem-loop
Stem-loop
   -g  -     uc  u  cu       u -g      uca      ----   g 
5'   gu cccuc  gc gu  uuggcaa g  uagaac   cacugg    uga g
     || |||||  || ||  ||||||| |  ||||||   ||||||    |||  
3'   ca gggag  cg ca  aaccguu c  aucuug   guggcc    acu u
   ga  c     cc  c  uc       - ag      ---      uagg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002440.1: 28203080-28203176 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-182
ami-mir-183AKHW03002440.1: 28193869-28193956 [+]
ami-mir-96AKHW03002440.1: 28194110-28194206 [+]
ami-mir-182AKHW03002440.1: 28203080-28203176 [+]
Database links

Mature sequence ami-miR-182-5p

Accession MIMAT0038194
Sequence

17 - 

uuuggcaaugguagaacucacacu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-182-3p

Accession MIMAT0038195
Sequence

61 - 

ugguucuagacuugccaacu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).