Stem-loop sequence ami-mir-181b-2

AccessionMI0029765 (change log)
DescriptionAlligator mississippiensis miR-181b-2 stem-loop
Stem-loop
   -u  -    aau  -     aucaa         cu           uua  u 
5'   gc aucu   gg cugca     cauucauug  gucgguggguu   gu u
     || ||||   || |||||     |||||||||  |||||||||||   ||  
3'   cg uaga   cc ggcgu     guaaguaac  uagucacucaa   ca g
   au  a    ---  a     caaac         --           --c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004379.1: 113566-113663 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-181b-2
ami-mir-181a-2AKHW03004379.1: 111738-111830 [+]
ami-mir-181b-2AKHW03004379.1: 113566-113663 [+]
Database links

Mature sequence ami-miR-181b-5p

Accession MIMAT0038190
Sequence

21 - 

aacauucauugcugucgguggguu

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-181b-2-3p

Accession MIMAT0038192
Sequence

58 - 

acucacugaucaaugaaugca

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).