Stem-loop sequence ami-mir-181b-1

AccessionMI0029764 (change log)
DescriptionAlligator mississippiensis miR-181b-1 stem-loop
Stem-loop
   ---aa       aucaa         cug           aa  a 
5'      ggucaca     cauucauug   ucgguggguuu  cu u
        |||||||     |||||||||   |||||||||||  ||  
3'      ccggugu     guaaguaac   agucacucgaa  gg g
   ucacc       -caac         --a           ca  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003392.1: 1538979-1539064 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-181b-1
ami-mir-181a-1AKHW03003392.1: 1539171-1539262 [-]
ami-mir-181b-1AKHW03003392.1: 1538979-1539064 [-]
Database links

Mature sequence ami-miR-181b-5p

Accession MIMAT0038190
Sequence

13 - 

aacauucauugcugucgguggguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-181b-3p

Accession MIMAT0038191
Sequence

53 - 

cucacugaacaaugaaugcaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).