Stem-loop sequence ami-mir-181a-2

AccessionMI0029762 (change log)
DescriptionAlligator mississippiensis miR-181a-2 stem-loop
Stem-loop
   -ca     -      u a   u      cu       a    gagcau 
5'    gauag cuucag g aca ucaacg  gucggug guuu      u
      ||||| |||||| | ||| ||||||  ||||||| ||||       
3'    cuauu ggaguu c ugu aguugc  cagcuac caaa      a
   aca     u      c a   c      --       -    aaaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004379.1: 111738-111830 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-181a-2
ami-mir-181a-2AKHW03004379.1: 111738-111830 [+]
ami-mir-181b-2AKHW03004379.1: 113566-113663 [+]
Database links

Mature sequence ami-miR-181a-5p

Accession MIMAT0038186
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-181a-2-3p

Accession MIMAT0038188
Sequence

57 - 

accaucgaccguugacuguacc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).