Stem-loop sequence ami-mir-181a-1

AccessionMI0029761 (change log)
DescriptionAlligator mississippiensis miR-181a-1 stem-loop
Stem-loop
   -      -   uc  u a   u      cu       a    gg  u 
5'  gugguu gcu  ag g aca ucaacg  gucggug guuu  au u
    |||||| |||  || | ||| ||||||  ||||||| ||||  || a
3'  uaccaa cga  uc c ugu aguugc  cagcuac caaa  ug a
   c      u   cc  c a   u      --       -    ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003392.1: 1539171-1539262 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-181a-1
ami-mir-181a-1AKHW03003392.1: 1539171-1539262 [-]
ami-mir-181b-1AKHW03003392.1: 1538979-1539064 [-]
Database links

Mature sequence ami-miR-181a-5p

Accession MIMAT0038186
Sequence

16 - 

aacauucaacgcugucggugagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-181a-3p

Accession MIMAT0038187
Sequence

56 - 

accaucgaccguugauuguacc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).