Stem-loop sequence ami-mir-153-1

AccessionMI0029758 (change log)
DescriptionAlligator mississippiensis miR-153-1 stem-loop
Stem-loop
   -ucu            g  -             -       cgu  uc 
5'     cgcggcugccgg gg cauuuuugugauu ugcagcu   gg  u
       |||||||||||| || ||||||||||||| |||||||   ||  g
3'     gcgccggcggcu cu gugaaaacacuga acguuga   cc  g
   gucc            g  a             u       ---  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002857.1: 22521-22613 [-]
intergenic
Database links

Mature sequence ami-miR-153-3p

Accession MIMAT0038184
Sequence

55 - 

uugcauagucacaaaagugauc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).