Stem-loop sequence ami-mir-152

AccessionMI0029757 (change log)
DescriptionAlligator mississippiensis miR-152 stem-loop
Stem-loop
       -   c              g  a    u  --a   gga 
5' gucc ucu agcucagguucugu gu cacu gg   cuc   c
   |||| ||| |||||||||||||| || |||| ||   |||    
3' cagg agg uuggguucaagaca ua guga cu   gag   u
       u   u              g  c    -  gac   guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000817.1: 2942464-2942547 [-]
intergenic
Database links

Mature sequence ami-miR-152-5p

Accession MIMAT0038182
Sequence

14 - 

agguucugugguacacuuggac

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-152-3p

Accession MIMAT0038183
Sequence

52 - 

ucagugcaugacagaacuugg

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).