Stem-loop sequence ami-mir-147

AccessionMI0029754 (change log)
DescriptionAlligator mississippiensis miR-147 stem-loop
Stem-loop
   ----u      u    c   ug   u            ---aac      
5'      acucua gaau uag  gaa cauuucugcaca      ucgac 
        |||||| |||| |||  ||| ||||||||||||      |||| u
3'      ugggau uuua auc  cuu guaaaggcgugu      aguua 
   cccuc      u    c   gu   c            gacuaa      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006295.1: 16718613-16718704 [-]
intergenic
Database links

Mature sequence ami-miR-147-5p

Accession MIMAT0038176
Sequence

17 - 

uggaaucauuucugcacaaacu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-147-3p

Accession MIMAT0038177
Sequence

54 - 

gugugcggaaaugcuucugcu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).