Stem-loop sequence ami-mir-146c

AccessionMI0029753 (change log)
DescriptionAlligator mississippiensis miR-146c stem-loop
Stem-loop
   --g    uu  c    cu         auu c         uucccuc 
5'    gcag  cc agcu  gagaacuga   c auggacugg       u
      ||||  || ||||  |||||||||   | |||||||||        
3'    uguc  gg ucga  cucuugacu   g uaccugacu       u
   cua    --  u    -u         gau a         ucuauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03004653.1: 5690404-5690496 [-]
intergenic
Database links

Mature sequence ami-miR-146c-5p

Accession MIMAT0038174
Sequence

16 - 

ugagaacugaauuccauggacug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-146c-3p

Accession MIMAT0038175
Sequence

59 - 

guccauaguagucaguucucu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).