Stem-loop sequence ami-mir-143

AccessionMI0029748 (change log)
DescriptionAlligator mississippiensis miR-143 stem-loop
Stem-loop
   aug      ag   a  g         g      u  -   g 
5'    ucuccc  ccc ag ugcagugcu caucuc gg uca u
      ||||||  ||| || ||||||||| |||||| || |||  
3'    ggaggg  ggg uc augucacga guagag cu agu u
   caa      aa   c  g         a      u  g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006437.1: 13479112-13479196 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-143
ami-mir-143AKHW03006437.1: 13479112-13479196 [-]
ami-mir-145AKHW03006437.1: 13478292-13478382 [-]
Database links

Mature sequence ami-miR-143-5p

Accession MIMAT0038165
Sequence

17 - 

ggugcagugcugcaucucugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-143-3p

Accession MIMAT0038166
Sequence

51 - 

ugagaugaagcacuguagcuc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).