Stem-loop sequence ami-mir-137a

AccessionMI0029740 (change log)
DescriptionAlligator mississippiensis miR-137a stem-loop
Stem-loop
   ----ucug           ug   g           ug a     -  g 
5'         acucucuucgg  acg guauucuuggg  g uaaua cg a
           |||||||||||  ||| |||||||||||  | ||||| || u
3'         ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   cggcgcca           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006584.1: 1882832-1882926 [+]
intergenic
Database links

Mature sequence ami-miR-137a-3p

Accession MIMAT0038153
Sequence

54 - 

uuauugcuuaagaauacgcgua

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).