Stem-loop sequence ami-mir-135-3

AccessionMI0029739 (change log)
DescriptionAlligator mississippiensis miR-135-3 stem-loop
Stem-loop
   -c      c                 uau          -   cu 
5'   ccucug uguggucuauggcuuuu   uccuauguga uug  u
     |||||| |||||||||||||||||   |||||||||| |||  u
3'   ggagac acaucggguaccgaaaa   gggauguacu aau  u
   ua      -                 -uc          c   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006286.1: 1169621-1169709 [+]
intergenic
Database links

Mature sequence ami-miR-135-5p

Accession MIMAT0038149
Sequence

16 - 

uauggcuuuuuauuccuaugug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-135-3-3p

Accession MIMAT0038152
Sequence

55 - 

auguagggcuaaaagccaugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).