Stem-loop sequence ami-mir-135-1

AccessionMI0029737 (change log)
DescriptionAlligator mississippiensis miR-135-1 stem-loop
Stem-loop
   u    c      a         uu            uuauac 
5'  ccca uguguu uauggcuuu  auuccuauguga      u
    |||| |||||| |||||||||  ||||||||||||       
3'  gggu gcauaa gugccgaag  uagggauauacu      a
   g    c      c         -u            uuccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006215.1: 3671040-3671124 [+]
intergenic
Database links

Mature sequence ami-miR-135-5p

Accession MIMAT0038149
Sequence

14 - 

uauggcuuuuuauuccuaugug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-135-3p

Accession MIMAT0038150
Sequence

53 - 

auauagggauugaagccgugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).