Stem-loop sequence ami-mir-133b

AccessionMI0029736 (change log)
DescriptionAlligator mississippiensis miR-133b stem-loop
Stem-loop
   agcu     cu            ca  c  a      u  g   u 
5'     gcacu  gcuguggcuggu  aa gg accaag cc ucu c
       |||||  ||||||||||||  || || |||||| || ||| c
3'     cguga  cgauaucgacca  uu cc ugguuu gg agg u
   -agu     --            ac  c  c      -  -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03003504.1: 2019326-2019413 [+]
intergenic
Clustered miRNAs
< 10kb from ami-mir-133b
ami-mir-206AKHW03003504.1: 2014183-2014271 [+]
ami-mir-133bAKHW03003504.1: 2019326-2019413 [+]
Database links

Mature sequence ami-miR-133b-3p

Accession MIMAT0038148
Sequence

55 - 

uuugguccccuucaaccagcua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).