Stem-loop sequence ami-mir-130b

AccessionMI0029730 (change log)
DescriptionAlligator mississippiensis miR-130b stem-loop
Stem-loop
   ------  aug      u    a        uc         a  g -  a 
5'       gu   cuguug ccag gcccuuuu  uguuguacu cu g ca u
         ||   |||||| |||| ||||||||  ||||||||| || | ||  
3'       ca   gacggu gguu cgggaaaa  auaacguga ga u gu u
   ccagua  -aa      c    a        uu         c  g a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03002185.1: 25772-25867 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-130b
ami-mir-130bAKHW03002185.1: 25772-25867 [-]
ami-mir-301bAKHW03002185.1: 24520-24616 [-]
ami-mir-454AKHW03002185.1: 17721-17813 [-]
Database links

Mature sequence ami-miR-130b-5p

Accession MIMAT0038141
Sequence

18 - 

gcccuuuuucuguuguacua

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-130b-3p

Accession MIMAT0038142
Sequence

55 - 

cagugcaauauuaaaagggcau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).