Stem-loop sequence ami-mir-128-1

AccessionMI0029725 (change log)
DescriptionAlligator mississippiensis miR-128-1 stem-loop
Stem-loop
   -cau    u      uuc       uaa      cu      gu 
5'     gagc guugga   ggggccg   cacugu  gagagg  u
       |||| ||||||   |||||||   ||||||  ||||||   
3'     uucg cgacuu   cucuggc   gugaca  cucuuu  a
   gucc    u      uuu       caa      --      ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03006853.1: 34149771-34149857 [-]
intergenic
Database links

Mature sequence ami-miR-128-5p

Accession MIMAT0038133
Sequence

17 - 

cggggccguaacacugucugaga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-128-3p

Accession MIMAT0038134
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).