Stem-loop sequence ami-mir-124-2

AccessionMI0029718 (change log)
DescriptionAlligator mississippiensis miR-124-2 stem-loop
Stem-loop
   -    cgg     u   c   cc        a   ga        uaau 
5'  uucc   ggcuc cgc ucu  guguucac gcg  ccuugauu    g
    ||||   ||||| ||| |||  |||||||| |||  ||||||||    u
3'  aagg   ccgag gcg aga  cguaagug cgc  ggaauuaa    c
   g    ---     -   -   ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03005657.1: 12011211-12011305 [-]
intergenic
Database links

Mature sequence ami-miR-124-5p

Accession MIMAT0038125
Sequence

22 - 

cguguucacagcggaccuugau

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-124-3p

Accession MIMAT0038126
Sequence

59 - 

uaaggcacgcggugaaugcca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).