Stem-loop sequence ami-mir-124-1

AccessionMI0029717 (change log)
DescriptionAlligator mississippiensis miR-124-1 stem-loop
Stem-loop
   g  ccc        uc   - c        a   ga        uaaau 
5'  gc   gcggcccc  ucu g guguucac gcg  ccuugauu     g
    ||   ||||||||  ||| | |||||||| |||  ||||||||     u
3'  cg   cgccgggg  aga c cguaagug cgc  ggaauuaa     c
   -  cuc        ca   a -        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001328.1: 1926491-1926588 [-]
intergenic
Database links

Mature sequence ami-miR-124-5p

Accession MIMAT0038125
Sequence

21 - 

cguguucacagcggaccuugau

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-124-3p

Accession MIMAT0038126
Sequence

60 - 

uaaggcacgcggugaaugcca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).