Stem-loop sequence ami-mir-107

AccessionMI0029715 (change log)
DescriptionAlligator mississippiensis miR-107 stem-loop
Stem-loop
   -   -             --c    u  u           c   uu   u 
5'  gua uucucuuugcuuu   agcu cu uacagugcugc uug  gca u
    ||| |||||||||||||   |||| || ||||||||||| |||  |||  
3'  cgu gagagaggcgaaa   ucgg ga auguuacgacg aac  ugu u
   a   c             cua    -  c           -   --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ami-miR-107-5p

Accession MIMAT0038121
Sequence

18 - 

agcuucuuuacagugcugccuug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-107-3p

Accession MIMAT0038122
Sequence

55 - 

agcagcauuguacagggcuau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).