Stem-loop sequence ami-mir-106

AccessionMI0029714 (change log)
DescriptionAlligator mississippiensis miR-106 stem-loop
Stem-loop
   a          -a    g  ug  g     g    ug  g 
5'  ucccagggcu  aagu cu  ca ugcag uagc  gc c
    ||||||||||  |||| ||  || ||||| ||||  ||  
3'  ggggucucga  uucg gg  gu acguc aucg  cg u
   a          cg    g  gu  g     -    --  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000196.1: 16536-16613 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-106
ami-mir-106AKHW03000196.1: 16536-16613 [-]
ami-mir-93AKHW03000196.1: 16336-16426 [-]
Database links

Mature sequence ami-miR-106-5p

Accession MIMAT0038120
Sequence

11 - 

uaaagugcuugcagugcaggu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).