Stem-loop sequence ami-mir-98

AccessionMI0029707 (change log)
DescriptionAlligator mississippiensis miR-98 stem-loop
Stem-loop
   -   u                 c    ggggg    g     a 
5'  ggg gagguaguaaguuguau guug     ucgg auugg g
    ||| ||||||||||||||||| ||||     |||| |||||  
3'  ccc uuucaucauucaacaua caau     agcu uggcc c
   u   -                 u    ---gg    g     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03001570.1: 7585-7667 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-98
ami-let-7f-1AKHW03001570.1: 8030-8126 [-]
ami-mir-98AKHW03001570.1: 7585-7667 [-]
Database links

Mature sequence ami-miR-98-5p

Accession MIMAT0038108
Sequence

4 - 

ugagguaguaaguuguaucguu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-98-3p

Accession MIMAT0038109
Sequence

61 - 

cuauacaacuuacuacuuucc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).