Stem-loop sequence ami-mir-93

AccessionMI0029705 (change log)
DescriptionAlligator mississippiensis miR-93 stem-loop
Stem-loop
   cuu a       u     -ca            u    g   u   ug 
5'    g gcugcgg ggcuc   aagugcuguucg gcag uag gug  c
      | ||||||| |||||   |||||||||||| |||| ||| |||   
3'    c cgacgcc ccgag   uucacgacgggc cguc auc uac  a
   --g -       c     ccc            -    -   -   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM28112v4; GCA_000281125.4) Overlapping transcripts
AKHW03000196.1: 16336-16426 [-]
intergenic
Clustered miRNAs
< 10kb from ami-mir-93
ami-mir-106AKHW03000196.1: 16536-16613 [-]
ami-mir-93AKHW03000196.1: 16336-16426 [-]
Database links

Mature sequence ami-miR-93-5p

Accession MIMAT0038104
Sequence

19 - 

caaagugcuguucgugcagguag

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ami-miR-93-3p

Accession MIMAT0038105
Sequence

56 - 

uacugccgggcagcacuuccc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).